../../tmp/servers/virsirnadb/1394288422
Result for your query siRNA sequence
| RED | =100 % Complementary sequence |
| . | =Identical residue |
| blue alphabets | =mismatch |
| _ | =Gap |
| Acc number | Strain name | Start | Alignment | End | % Identity |
| Query | virsi2008 | 1 | tgagcacaaatcctaaaccc | 20 | |
| D89815.1 | Hepatitis C virus genomic RNA, complete sequence | 343 | .................... | 362 | 100 |
| AF165049.1 | Hepatitis C virus subtype 1b strain MD3-1, complete genome | 331 | .................... | 350 | 100 |
| AF165050.1 | Hepatitis C virus subtype 1b strain MD3-2, complete genome | 331 | .................... | 350 | 100 |
| AF165061.1 | Hepatitis C virus subtype 1b strain MD9-1, complete genome | 331 | .................... | 350 | 100 |
| AF165062.1 | Hepatitis C virus subtype 1b strain MD9-2, complete genome | 331 | .................... | 350 | 100 |
| AY045702.1 | Hepatitis C virus isolate HCR6, complete genome | 345 | .................... | 364 | 100 |
| FJ025854.1 | Hepatitis C virus strain P026 polyprotein gene, complete cds | 192 | .................... | 211 | 100 |
| X61596.1 | Hepatitis C virus core, E1, NS1/E2, NS2, NS3, NS4a, NS4b and NS5 gene | 326 | ..................._ | 344 | 95 |
| D10988.1 | HPCJ8G Hepatitis C virus genome | 343 | ..................._ | 361 | 95 |
| D90208.1 | HPCJCG Hepatitis C virus ORF gene, complete cds | 331 | ..................._ | 349 | 95 |
| D00944.1 | HPCPOLP Hepatitis C virus genomic RNA for polyprotein, complete cds | 342 | ..................._ | 360 | 95 |
| D50482.1 | HPCK1R3 Hepatitis C virus (strain HCV-1b, clone HCV-K1-R3), complete g | 331 | ..................._ | 349 | 95 |
| D50484.1 | HPCK1S3 Hepatitis C virus (strain HCV-1b, clone HCV-K1-S3), complete g | 331 | ..................._ | 349 | 95 |
| D50409.1 | Hepatitis C virus (isolate BEBE1) genomic RNA, complete genome | 342 | ..................._ | 360 | 95 |
| D89872.1 | Hepatitis C virus RNA for polyprotein, complete cds | 2 | ..................._ | 20 | 95 |
| U89019.1 | HCU89019 Hepatitis C virus subtype 1b, complete genome | 342 | ..................._ | 360 | 95 |
| AB016785.1 | Hepatitis C virus genomic RNA, complete sequence | 344 | ..................._ | 362 | 95 |
| AF165046.1 | Hepatitis C virus subtype 1b strain MD1-2, complete genome | 331 | ..................._ | 349 | 95 |
| AF165051.1 | Hepatitis C virus subtype 1b strain MD4-1, complete genome | 331 | ..................._ | 349 | 95 |
| AF165052.1 | Hepatitis C virus subtype 1b strain MD4-2, complete genome | 331 | ..................._ | 349 | 95 |
| AF165053.1 | Hepatitis C virus subtype 1b strain MD5-1, complete genome | 331 | ..................._ | 349 | 95 |
| AF165054.1 | Hepatitis C virus subtype 1b strain MD5-2, complete genome | 331 | ..................._ | 349 | 95 |
| AF165055.1 | Hepatitis C virus subtype 1b strain MD6-1, complete genome | 331 | ..................._ | 349 | 95 |
| AF165057.1 | Hepatitis C virus subtype 1b strain MD7-1, complete genome | 331 | ..................._ | 349 | 95 |
| AF165058.1 | Hepatitis C virus subtype 1b strain MD7-2, complete genome | 331 | ..................._ | 349 | 95 |
| AF165063.1 | Hepatitis C virus subtype 1b strain MD10-1, complete genome | 331 | ..................._ | 349 | 95 |
| AF165064.1 | Hepatitis C virus subtype 1b strain MD10-2, complete genome | 331 | ..................._ | 349 | 95 |
| AB031663.1 | Hepatitis C virus (isolate VAT96) genomic RNA, complete genome | 343 | ..................._ | 361 | 95 |
| AF169002.1 | Hepatitis C virus subtype 2a isolate NDM228, complete genome | 342 | ..................._ | 360 | 95 |
| AF169003.1 | Hepatitis C virus subtype 2a isolate G2aK1, complete genome | 342 | ..................._ | 360 | 95 |
| AF169005.1 | Hepatitis C virus subtype 2a isolate NDM59, complete genome | 342 | ..................._ | 360 | 95 |
| AF238481.1 | Hepatitis C virus subtype 2a strain MD2a-1, complete genome | 308 | ..................._ | 326 | 95 |
| AF238482.1 | Hepatitis C virus subtype 2a strain MD2a-2, complete genome | 308 | ..................._ | 326 | 95 |
| AF238483.1 | Hepatitis C virus subtype 2a strain MD2a-4, complete genome | 308 | ..................._ | 326 | 95 |
| AF238484.1 | Hepatitis C virus subtype 2a strain MD2a-5, complete genome | 308 | ..................._ | 326 | 95 |
| AF238485.1 | Hepatitis C virus subtype 2a strain MD2a-7, complete genome | 308 | ..................._ | 326 | 95 |
| AF238486.1 | Hepatitis C virus subtype 2b strain MD2b-1, complete genome | 306 | ..................._ | 324 | 95 |
| AF207752.1 | Hepatitis C virus subtype 1b strain MD11, complete genome | 331 | ..................._ | 349 | 95 |
| AF207753.1 | Hepatitis C virus subtype 1b strain MD12, complete genome | 331 | ..................._ | 349 | 95 |
| AF207755.1 | Hepatitis C virus subtype 1b strain MD14, complete genome | 331 | ..................._ | 349 | 95 |
| AF207757.1 | Hepatitis C virus subtype 1b strain MD16, complete genome | 331 | ..................._ | 349 | 95 |
| AF207759.1 | Hepatitis C virus subtype 1b strain MD18, complete genome | 331 | ..................._ | 349 | 95 |
| AF207764.1 | Hepatitis C virus subtype 1b strain MD23, complete genome | 331 | ..................._ | 349 | 95 |
| AF207765.1 | Hepatitis C virus subtype 1b strain MD24, complete genome | 331 | ..................._ | 349 | 95 |
| AF207768.1 | Hepatitis C virus subtype 1b strain MD27, complete genome | 331 | ..................._ | 349 | 95 |
| AF207770.1 | Hepatitis C virus subtype 1b strain MD29, complete genome | 331 | ..................._ | 349 | 95 |
| AF207771.1 | Hepatitis C virus subtype 1b strain MD30, complete genome | 331 | ..................._ | 349 | 95 |
| AF207773.1 | Hepatitis C virus subtype 1b strain MD32, complete genome | 331 | ..................._ | 349 | 95 |
| AB030907.1 | Hepatitis C virus (isolate JPUT971017) genomic RNA, complete genome | 343 | ..................._ | 361 | 95 |
| AB049087.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT05 | 312 | ..................._ | 330 | 95 |
| AB049088.1 | Hepatitis C virus genomic RNA, complete genome, isolate: HCVT094 | 343 | ..................._ | 361 | 95 |
| AB049089.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT10 | 312 | ..................._ | 330 | 95 |
| AB049091.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT14 | 261 | ..................._ | 279 | 95 |
| AB049092.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT14 | 312 | ..................._ | 330 | 95 |
| AB049094.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT16 | 344 | ..................._ | 362 | 95 |
| AB049095.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT16 | 312 | ..................._ | 330 | 95 |
| AB049096.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT19 | 312 | ..................._ | 330 | 95 |
| AB049101.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT22 | 312 | ..................._ | 330 | 95 |
| AF333324.1 | Hepatitis C virus type 1b polyprotein mRNA, complete cds | 343 | ..................._ | 361 | 95 |
| AB047639.1 | Hepatitis C virus (isolate JFH-1) genomic RNA, complete genome | 342 | ..................._ | 360 | 95 |
| AB047642.1 | Hepatitis C virus gene for polyprotein, complete cds, clone:JCH-3 | 342 | ..................._ | 360 | 95 |
| AB047643.1 | Hepatitis C virus gene for polyprotein, complete cds, clone:JCH-4 | 342 | ..................._ | 360 | 95 |
| AB047644.1 | Hepatitis C virus gene for polyprotein, complete cds, clone:JCH-5 | 342 | ..................._ | 360 | 95 |
| AB047645.1 | Hepatitis C virus gene for polyprotein, complete cds, clone:JCH-6 | 342 | ..................._ | 360 | 95 |
| AY232730.1 | Hepatitis C virus clone MD2b1-1 polyprotein mRNA, complete cds | 306 | ..................._ | 324 | 95 |
| AY232731.1 | Hepatitis C virus clone MD2b1-2 polyprotein mRNA, complete cds | 306 | ..................._ | 324 | 95 |
| AY232732.1 | Hepatitis C virus clone MD2b2-1 polyprotein mRNA, complete cds | 306 | ..................._ | 324 | 95 |
| AY232733.1 | Hepatitis C virus clone MD2b2-2 polyprotein mRNA, complete cds | 306 | ..................._ | 324 | 95 |
| AY232734.1 | Hepatitis C virus clone MD2b3-1 polyprotein mRNA, complete cds | 306 | ..................._ | 324 | 95 |
| AY232735.1 | Hepatitis C virus clone MD2b3-2 polyprotein mRNA, complete cds | 306 | ..................._ | 324 | 95 |
| AY232736.1 | Hepatitis C virus clone MD2b4-1 polyprotein mRNA, complete cds | 306 | ..................._ | 324 | 95 |
| AY232737.1 | Hepatitis C virus clone MD2b4-2 polyprotein mRNA, complete cds | 306 | ..................._ | 324 | 95 |
| AY232738.1 | Hepatitis C virus clone MD2b5-1 polyprotein mRNA, complete cds | 306 | ..................._ | 324 | 95 |
| AY232739.1 | Hepatitis C virus clone MD2b5-2 polyprotein mRNA, complete cds | 306 | ..................._ | 324 | 95 |
| AY232740.1 | Hepatitis C virus clone MD2b6-1 polyprotein mRNA, complete cds | 306 | ..................._ | 324 | 95 |
| AY232741.1 | Hepatitis C virus clone MD2b6-2 polyprotein mRNA, complete cds | 306 | ..................._ | 324 | 95 |
| AY232742.1 | Hepatitis C virus clone MD2b7-1 polyprotein mRNA, complete cds | 306 | ..................._ | 324 | 95 |
| AY232743.1 | Hepatitis C virus clone MD2b7-2 polyprotein mRNA, complete cds | 306 | ..................._ | 324 | 95 |
| AY232744.1 | Hepatitis C virus clone MD2b8-1 polyprotein mRNA, complete cds | 306 | ..................._ | 324 | 95 |
| AY232745.1 | Hepatitis C virus clone MD2b8-2 polyprotein mRNA, complete cds | 306 | ..................._ | 324 | 95 |
| AY232746.1 | Hepatitis C virus clone MD2b9-1 polyprotein mRNA, complete cds | 306 | ..................._ | 324 | 95 |
| AY232747.1 | Hepatitis C virus clone MD2b9-2 polyprotein mRNA, complete cds | 306 | ..................._ | 324 | 95 |
| AY587845.1 | Hepatitis C virus strain RF1_2k/1b, N687 polyprotein gene, complete c | 270 | ..................._ | 288 | 95 |
| AY746460.1 | Hepatitis C virus genotype 2a polyprotein gene, complete cds | 342 | ..................._ | 360 | 95 |
| AB154200.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 331 | ..................._ | 349 | 95 |
| DQ155561.1 | Hepatitis C virus (isolate D54) polyprotein gene, partial cds | 315 | ..................._ | 333 | 95 |
| EF026073.1 | Hepatitis C virus strain RF3 2/5 polyprotein mRNA, partial cds | 320 | ..................._ | 338 | 95 |
| DQ988076.1 | Hepatitis C virus isolate Eg7 polyprotein gene, partial cds | 261 | ..................._ | 279 | 95 |
| AM408911.1 | Hepatitis C virus partial gene for polyprotein, recombinant 2/5, geno | 320 | ..................._ | 338 | 95 |
| EF407470.1 | Hepatitis C virus isolate 4064 polyprotein gene, complete cds | 295 | ..................._ | 313 | 95 |
| EU482859.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V272/2003, complet | 291 | ..................._ | 309 | 95 |
| EU482887.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V66/2002, complete | 238 | ..................._ | 256 | 95 |
| AB429050.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: AH1 | 343 | ..................._ | 361 | 95 |
| EU255950.1 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V241/2005, complet | 261 | ..................._ | 279 | 95 |
| EU256097.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V324/2001, complet | 269 | ..................._ | 287 | 95 |
| EU256102.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V415/2001, complet | 291 | ..................._ | 309 | 95 |
| EU256030.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V87/2002, complete | 252 | ..................._ | 270 | 95 |
| AB442219.1 | Hepatitis C virus subtype 1b genomic RNA, complete genome, clone: 1B- | 343 | ..................._ | 361 | 95 |
| AB442220.1 | Hepatitis C virus subtype 1b genomic RNA, complete genome, clone: KAH | 343 | ..................._ | 361 | 95 |
| FJ025855.1 | Hepatitis C virus strain P212 polyprotein gene, complete cds | 192 | ..................._ | 210 | 95 |
| FJ025856.1 | Hepatitis C virus strain P245 polyprotein gene, complete cds | 192 | ..................._ | 210 | 95 |
| FJ821465.1 | Hepatitis C virus strain M21-2k/1b, complete genome | 317 | ..................._ | 335 | 95 |
| AB559564.1 | Hepatitis C virus HCV gene for hepatitis C virus polyprotein, complet | 343 | ..................._ | 361 | 95 |
| HM777359.1 | Hepatitis C virus isolate C1292 genotype 2j, complete genome | 262 | ..................._ | 280 | 95 |
| FN666428.2 | Hepatitis C virus gene for polyprotein, genomic RNA, subtype 2q, isol | 315 | ..................._ | 333 | 95 |
| AF177036.1 | Hepatitis C virus subtype 2a strain HC-J6CH clone pJ6CF, complete gen | 342 | ..................._ | 360 | 95 |
| D30613.1 | HPCPP Hepatitis C virus complete genome sequence | 343 | .............a...... | 362 | 95 |
| D63822.1 | HPCJK046E2 Hepatitis C virus (isolate JK046) genomic RNA, complete gen | 340 | .............a...... | 359 | 95 |
| D45172.1 | HPCHCPO Hepatitis C virus genomic RNA for HCV polyprotein, complete cd | 343 | .............a...... | 362 | 95 |
| AF207762.1 | Hepatitis C virus subtype 1b strain MD21, complete genome | 331 | .......g............ | 350 | 95 |
| AF290978.1 | Hepatitis C virus subtype 1a isolate colonel, complete genome | 331 | .......g............ | 350 | 95 |
| DQ314806.1 | Hepatitis C virus subtype 6g isolate HK6554, complete genome | 340 | .............a...... | 359 | 95 |
| EU362877.1 | Hepatitis C virus isolate 1024_FU24 polyprotein (pol) gene, complete | 248 | .......g............ | 267 | 95 |
| EU362895.1 | Hepatitis C virus isolate 7043_FU24 polyprotein (pol) gene, complete | 261 | .......g............ | 280 | 95 |
| EU482877.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V342/2001, complet | 291 | .......g............ | 310 | 95 |
| EU155267.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V391/2006, complet | 249 | .......g............ | 268 | 95 |
| EU155351.2 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V257/2003, complet | 264 | .......g............ | 283 | 95 |
| EU569723.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V13/2005, complete | 262 | .......g............ | 281 | 95 |
| EU255929.1 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V233/2004, complet | 269 | .......g............ | 288 | 95 |
| EU255940.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V433/2006, complet | 276 | .......g............ | 295 | 95 |
| EU255941.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V697/2006, complet | 275 | .......g............ | 294 | 95 |
| EU256068.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V405/2006, complet | 263 | .......g............ | 282 | 95 |
| EU255999.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V116/2002, complet | 256 | .......g............ | 275 | 95 |
| EU256043.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V3/2005, complete | 238 | .......g............ | 257 | 95 |
| EU256072.1 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V238/2005, complet | 250 | .......g............ | 269 | 95 |
| EU256083.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V299/2005, complet | 291 | .......g............ | 310 | 95 |
| EU857431.1 | Hepatitis C virus subtype 1b isolate Whu, complete genome | 343 | .............a...... | 362 | 95 |
| EU862832.1 | Hepatitis C virus subtype 1a isolate HCV-1a/DE/BID-V27/2003, complete | 257 | .......g............ | 276 | 95 |
| D13558.1 | HPCJ483 Hepatitis C virus genome, complete sequence | 343 | .......g..........._ | 361 | 90 |
| D10750.1 | HPCJ491 Hepatitis C virus genome, complete sequence | 343 | .......g..........._ | 361 | 90 |
| D11168.1 | HPCJTA Hepatitis C virus (HCV) complete genome | 343 | .......g..........._ | 361 | 90 |
| D11355.1 | HPCJTB Hepatitis C virus genomic RNA, complete genome, strain: JT' | 343 | .......g..........._ | 361 | 90 |
| M96362.1 | HPCUNKCDS Hepatitis C virus mRNA, complete cds | 344 | .......g..........._ | 362 | 90 |
| M67463.1 | HPCCGAA Hepatitis C virus subtype 1a, complete genome | 343 | .......g..........._ | 361 | 90 |
| L02836.1 | HPCCGENOM Hepatitis C virus subtype 1b strain HeBei, complete genome | 332 | .......g..........._ | 350 | 90 |
| M58335.1 | HPCHUMR Hepatitis C virus subtype 1b, complete genome | 334 | .......g..........._ | 352 | 90 |
| M62321.1 | HPCPLYPRE Hepatitis C virus subtype 1a, complete genome | 343 | .......g..........._ | 361 | 90 |
| S62220.1 | Hepatitis C virus subtype 1b, complete genome | 342 | .......g..........._ | 360 | 90 |
| U01214.1 | HCU01214 Hepatitis C virus subtype 1b strain HCV-L2, complete genome | 344 | .......g..........._ | 362 | 90 |
| D14853.1 | HPCCGS Hepatitis C virus (isolate HC-G9) genomic RNA, complete genome | 343 | .......g..........._ | 361 | 90 |
| D10934.1 | HPCRNA Hepatitis C virus RNA, complete genome sequence | 343 | .......g..........._ | 361 | 90 |
| U16362.1 | HCU16362 Hepatitis C virus subtype 1b, complete genome | 344 | .......g..........._ | 362 | 90 |
| D63857.1 | HPVHCVN Hepatitis C virus gene for E1 and E2/NS1 envelope glycoprotein | 250 | .......g..........._ | 268 | 90 |
| D50483.1 | HPCK1S1 Hepatitis C virus (strain HCV-1b, clone HCV-K1-S1), complete g | 331 | .......g..........._ | 349 | 90 |
| D50485.1 | HPCK1S2 Hepatitis C virus (strain HCV-1b, clone HCV-K1-S2), complete g | 331 | .......g..........._ | 349 | 90 |
| D50481.1 | HPCK1R2 Hepatitis C virus (strain HCV-1b, clone HCV-K1-R2), complete g | 331 | .......g..........._ | 349 | 90 |
| D50480.1 | HPCK1R1 Hepatitis C virus (strain HCV-1b, clone HCV-K1-R1), complete g | 331 | .......g..........._ | 349 | 90 |
| D14484.1 | HPCJRNA Hepatitis C virus strain J33 genomic RNA, complete genome | 343 | .......g..........._ | 361 | 90 |
| U45476.1 | HCU45476 Hepatitis C virus isolate HD-1, complete genome | 343 | .......g..........._ | 361 | 90 |
| D85516.1 | Hepatitis C virus genomic RNA, complete cds | 343 | .......g..........._ | 361 | 90 |
| AF011751.1 | Hepatitis C virus strain H77 pCV-H77C polyprotein gene, complete cds | 343 | .......g..........._ | 361 | 90 |
| AF011752.1 | Hepatitis C virus strain H77 pCV-H11 polyprotein gene, complete cds | 343 | .......g..........._ | 361 | 90 |
| AF011753.1 | Hepatitis C virus strain H77 pH21 polyprotein gene, complete cds | 343 | .......g..........._ | 361 | 90 |
| AJ000009.1 | Hepatitis C virus complete genome sequence | 326 | .......g..........._ | 344 | 90 |
| AF054247.1 | Hepatitis C virus subtype 1b strain HC-J4 isolate pCV-J4L6S, complete | 343 | .......g..........._ | 361 | 90 |
| AF054248.1 | Hepatitis C virus subtype 1b strain HC-J4 isolate pCV-J4L2S, complete | 343 | .......g..........._ | 361 | 90 |
| AF054249.1 | Hepatitis C virus subtype 1b strain HC-J4 isolate pCV-J4L4S, complete | 344 | .......g..........._ | 362 | 90 |
| AF054250.1 | Hepatitis C virus subtype 1b strain HC-J4, complete genome | 333 | .......g..........._ | 351 | 90 |
| AF064490.1 | Hepatitis C virus (isolate SA13) polyprotein gene, complete cds | 248 | .......g..........._ | 266 | 90 |
| AJ132996.1 | Hepatitis C virus, complete genome, isolate HCV-AD78 | 342 | .......g..........._ | 360 | 90 |
| AJ132997.1 | Hepatitis C virus, complete genome, isolate HCV-AD78P1 | 342 | .......g..........._ | 360 | 90 |
| AJ238799.1 | Hepatitis C virus type 1b complete genome, isolate Con1 | 343 | .......g..........._ | 361 | 90 |
| AF176573.1 | Hepatitis C virus subtype 1b strain 274933RU, complete genome | 343 | .......g..........._ | 361 | 90 |
| AJ238800.1 | Hepatitis C virus type 1b complete genome, isolate NC1 | 2 | .......g..........._ | 20 | 90 |
| AF165045.1 | Hepatitis C virus subtype 1b strain MD1-1, complete genome | 331 | .......g..........._ | 349 | 90 |
| AF165047.1 | Hepatitis C virus subtype 1b strain MD2-1, complete genome | 331 | .......g..........._ | 349 | 90 |
| AF165048.1 | Hepatitis C virus subtype 1b strain MD2-2, complete genome | 331 | .......g..........._ | 349 | 90 |
| AF165056.1 | Hepatitis C virus subtype 1b strain MD6-2, complete genome | 331 | .............c....._ | 349 | 90 |
| AF165059.1 | Hepatitis C virus subtype 1b strain MD8-1, complete genome | 331 | .......g..........._ | 349 | 90 |
| AF165060.1 | Hepatitis C virus subtype 1b strain MD8-2, complete genome | 331 | .......g..........._ | 349 | 90 |
| AF169004.1 | Hepatitis C virus subtype 2a isolate G2aK3, complete genome | 342 | ..........a........_ | 360 | 90 |
| AF208024.1 | Hepatitis C virus subtype 1b strain MD34, complete genome | 331 | .......g..........._ | 349 | 90 |
| AF207754.1 | Hepatitis C virus subtype 1b strain MD13, complete genome | 331 | .......g..........._ | 349 | 90 |
| AF207756.1 | Hepatitis C virus subtype 1b strain MD15, complete genome | 331 | .......g..........._ | 349 | 90 |
| AF207758.1 | Hepatitis C virus subtype 1b strain MD17, complete genome | 331 | .......g..........._ | 349 | 90 |
| AF207760.1 | Hepatitis C virus subtype 1b strain MD19, complete genome | 331 | .......g..........._ | 349 | 90 |
| AF207761.1 | Hepatitis C virus subtype 1b strain MD20, complete genome | 331 | .......g..........._ | 349 | 90 |
| AF207763.1 | Hepatitis C virus subtype 1b strain MD22, complete genome | 331 | .......g..........._ | 349 | 90 |
| AF207766.1 | Hepatitis C virus subtype 1b strain MD25, complete genome | 331 | .......g..........._ | 349 | 90 |
| AF207767.1 | Hepatitis C virus subtype 1b strain MD26, complete genome | 331 | .......g..........._ | 349 | 90 |
| AF207769.1 | Hepatitis C virus subtype 1b strain MD28, complete genome | 331 | .......g..........._ | 349 | 90 |
| AF207772.1 | Hepatitis C virus subtype 1b strain MD31, complete genome | 331 | .......g..........._ | 349 | 90 |
| AF207774.1 | Hepatitis C virus subtype 1b strain MD33, complete genome | 331 | .......g..........._ | 349 | 90 |
| AF271632.1 | Hepatitis C virus subtype 1a clone pHCV-1/SF9 A, complete genome | 343 | .......g..........._ | 361 | 90 |
| AJ278830.1 | Hepatitis C virus genomic RNA for polyprotein gene | 343 | .......g..........._ | 361 | 90 |
| AB049090.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT14 | 312 | .......g..........._ | 330 | 90 |
| AB049093.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT15 | 312 | .......g..........._ | 330 | 90 |
| AB049097.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT19 | 312 | .......g..........._ | 330 | 90 |
| AB049098.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT20 | 312 | .......g..........._ | 330 | 90 |
| AB049099.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT21 | 343 | .......g..........._ | 361 | 90 |
| AB049100.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT21 | 312 | .......g..........._ | 330 | 90 |
| AB047640.1 | Hepatitis C virus gene for polyprotein, complete cds, clone:JCH-1 | 342 | .............c....._ | 360 | 90 |
| AB047641.1 | Hepatitis C virus gene for polyprotein, complete cds, clone:JCH-2 | 342 | .........c........._ | 360 | 90 |
| AY051292.1 | Hepatitis C virus (isolate India) polyprotein mRNA, complete cds | 343 | .......g..........._ | 361 | 90 |
| AF483269.1 | Hepatitis C virus type 1b isolate HCV-TR1 from Turkey, complete genom | 308 | .......g..........._ | 326 | 90 |
| AF511948.1 | Hepatitis C virus isolate XF222 polyprotein-like gene, complete seque | 343 | .......g..........._ | 361 | 90 |
| AF511950.1 | Hepatitis C virus isolate XF224 polyprotein-like gene, complete seque | 315 | .......g..........._ | 333 | 90 |
| AF139594.2 | Hepatitis C virus subtype 1b strain HCV-N, complete genome | 343 | .......g..........._ | 361 | 90 |
| AB080299.1 | Hepatitis C virus genomic RNA, complete genome, isolate:M1LE | 343 | .......g..........._ | 361 | 90 |
| AY460204.1 | Hepatitis C virus from Shanghai, complete genome | 343 | .......g..........._ | 361 | 90 |
| AY587844.1 | Hepatitis C virus strain N589 polyprotein gene, complete cds | 291 | .......g..........._ | 309 | 90 |
| AY651061.1 | Hepatitis C virus isolate Khaja1, complete genome | 343 | .......g..........._ | 361 | 90 |
| AB154177.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 331 | .......g..........._ | 349 | 90 |
| AB154178.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 331 | .......g..........._ | 349 | 90 |
| AB154179.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 331 | .......g..........._ | 349 | 90 |
| AB154180.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 331 | .......g..........._ | 349 | 90 |
| AB154181.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 331 | .......g..........._ | 349 | 90 |
| AB154182.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 331 | .......g..........._ | 349 | 90 |
| AB154183.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 331 | .......g..........._ | 349 | 90 |
| AB154185.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 331 | .......g..........._ | 349 | 90 |
| AB154186.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 331 | .......g..........._ | 349 | 90 |
| AB154187.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 331 | .......g..........._ | 349 | 90 |
| AB154189.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 331 | .......g..........._ | 349 | 90 |
| AB154190.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 331 | .......g..........._ | 349 | 90 |
| AB154191.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 331 | .......g..........._ | 349 | 90 |
| AB154192.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 331 | .......g..........._ | 349 | 90 |
| AB154194.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 331 | .......g..........._ | 349 | 90 |
| AB154198.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 331 | .......g..........._ | 349 | 90 |
| AB154199.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 331 | .......g..........._ | 349 | 90 |
| AB154201.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 331 | .......g..........._ | 349 | 90 |
| AB154202.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 331 | .......g..........._ | 349 | 90 |
| AB154203.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 331 | .......g..........._ | 349 | 90 |
| AB154204.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 331 | .......g..........._ | 349 | 90 |
| AB154205.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 331 | .......g..........._ | 349 | 90 |
| AB154206.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 331 | .......g..........._ | 349 | 90 |
| AB191333.1 | Hepatitis C virus genomic RNA, complete genome, strain:0 | 343 | .......g..........._ | 361 | 90 |
| DQ071885.1 | Hepatitis C virus subtype 1b polyprotein mRNA, complete cds | 343 | .......g..........._ | 361 | 90 |
| AJ851228.1 | Hepatitis C virus gene for polyprotein, genomic RNA, isolate Equatori | 316 | .......g..........._ | 334 | 90 |
| DQ418782.1 | Hepatitis C virus subtype 4a isolate 01-09 polyprotein gene, complete | 256 | .......g..........._ | 274 | 90 |
| DQ418783.1 | Hepatitis C virus subtype 4a isolate 02-42 polyprotein gene, complete | 221 | .......g..........._ | 239 | 90 |
| DQ418784.1 | Hepatitis C virus subtype 4a isolate 02C polyprotein gene, complete c | 266 | .......g..........._ | 284 | 90 |
| DQ418785.1 | Hepatitis C virus isolate 02Q polyprotein gene, partial cds | 264 | .......g..........._ | 282 | 90 |
| DQ418786.1 | Hepatitis C virus subtype 4d isolate 03-18 polyprotein gene, complete | 236 | .......g..........._ | 254 | 90 |
| DQ418787.1 | Hepatitis C virus subtype 4a isolate F753 polyprotein gene, complete | 264 | .......g..........._ | 282 | 90 |
| DQ418788.1 | Hepatitis C virus subtype 4a isolate F7157 polyprotein gene, complete | 264 | .......g..........._ | 282 | 90 |
| DQ418789.1 | Hepatitis C virus subtype 4a isolate L835 polyprotein gene, complete | 263 | .......g..........._ | 281 | 90 |
| DQ516083.1 | Hepatitis C virus subtype 4d isolate 24 polyprotein gene, complete cd | 281 | .......g..........._ | 299 | 90 |
| DQ516084.1 | Hepatitis C virus subtype 4a isolate 25 polyprotein gene, complete cd | 281 | .......g..........._ | 299 | 90 |
| DQ988073.1 | Hepatitis C virus isolate Eg2 polyprotein gene, partial cds | 261 | .......g..........._ | 279 | 90 |
| DQ988074.1 | Hepatitis C virus isolate Eg3 polyprotein gene, partial cds | 261 | .......g..........._ | 279 | 90 |
| DQ988075.1 | Hepatitis C virus isolate Eg4 polyprotein gene, partial cds | 261 | .......g..........._ | 279 | 90 |
| DQ988077.1 | Hepatitis C virus isolate Eg9 polyprotein gene, partial cds | 262 | .......g..........._ | 280 | 90 |
| DQ988078.1 | Hepatitis C virus isolate Eg10 polyprotein gene, partial cds | 257 | .......g..........._ | 275 | 90 |
| EF032883.1 | Hepatitis C virus subtype 1a isolate 03-32_P1_10.16.03 polyprotein ge | 265 | .......g..........._ | 283 | 90 |
| EF032884.1 | Hepatitis C virus subtype 1a isolate 03-32_P2_5.14.04 polyprotein gen | 244 | .......g..........._ | 262 | 90 |
| EF032885.1 | Hepatitis C virus subtype 1a isolate 03-32_P4_11.5.05 polyprotein gen | 264 | .......g..........._ | 282 | 90 |
| EF032886.1 | Hepatitis C virus subtype 1a isolate BR601 polyprotein gene, complete | 270 | .......g..........._ | 288 | 90 |